hindiii restriction enzymes (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
Structured Review
New England Biolabs
hindiii restriction enzymes
Hindiii Restriction Enzymes, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 10752 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/hindiii/HindIII/pmc13180767-58-26-29
Average 99 stars, based on 10752 article reviews
Hindiii Restriction Enzymes, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 10752 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/hindiii/HindIII/pmc13180767-58-26-29
Average 99 stars, based on 10752 article reviews
hindiii restriction enzymes - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Bioprocessing:Article Title: In vivo base editing via single myotrophic adeno-associated viruses in dystrophic mouse muscle and satellite cells Article Snippet: .. The AAV-EFS-SaABE8eV106W-bGH-U6-sgRNA-BsmBI was a gift from David Liu (Addgene plasmid # 189924 ; http://n2t.net/addgene:189924 ; RRID:Addgene_189924). gRNA targeting mdx 4cv premature stop codon (4cv-gRNA1: 5’ AGAACAGGAGACAACAGTTGA 3’ or 4cv-gRNA2: 5’ CTGCAGAACAGGAGACAACAG 3’) or a non-targeting gRNA (GCTTTCACGGAGGTTCGACG) was cloned with Plasmid Preparation:Article Title: In vivo base editing via single myotrophic adeno-associated viruses in dystrophic mouse muscle and satellite cells Article Snippet: .. The AAV-EFS-SaABE8eV106W-bGH-U6-sgRNA-BsmBI was a gift from David Liu (Addgene plasmid # 189924 ; http://n2t.net/addgene:189924 ; RRID:Addgene_189924). gRNA targeting mdx 4cv premature stop codon (4cv-gRNA1: 5’ AGAACAGGAGACAACAGTTGA 3’ or 4cv-gRNA2: 5’ CTGCAGAACAGGAGACAACAG 3’) or a non-targeting gRNA (GCTTTCACGGAGGTTCGACG) was cloned with Article Title: LABCG1 Affects Leishmania ( Leishmania ) Amazonensis Infectivity but Not Virulence or Sand Fly Infection. Article Snippet: .. Both the PCR product and the pSPαZEOα vector were digested with XbaI (Invitrogen) and Article Title: Human respiratory syncytial virus regulates the expression of interferon-stimulated genes through modulation of fibrillarin. Article Snippet: .. Both the plasmid and the PCR-amplified insert were digested with the restriction enzymes BglII (New England Biolabs, #R0144S) and Article Title: Emergence and evolution of chimeric pseudogenes (φgenes) contribute to genetic and functional diversity of the human genome Article Snippet: For the full-length and Δ constructs (Δ1 and Δ2) in pUAST, KpnI-HF (NEB, #R3142S) and NotI (NEB, #R0189S) were employed; Δ UP (upstream region) was achieved using NdeI (NEB, #R0111S) and BglII (NEB, #R0144S); Δ TATA promoter using SbfI-HF (NEB, #R3642S) and BglII. .. For insertion of RMND5A and ANAPC1 sequences into the pGL3 vector, digestion was performed using KpnI and Article Title: Emergence and evolution of chimeric pseudogenes (φgenes) contribute to genetic and functional diversity of the human genome. Article Snippet: For the full-length and constructs ( 1 and 2) in pUAST, KpnI-HF (NEB, #R3142S) and NotI (NEB, #R0189S) were employed; UP (upstream region) was achieved using NdeI (NEB, #R0111S) and BglII (NEB, #R0144S); TATA promoter using SbfI-HF (NEB, #R3642S) and BglII. .. For insertion of RMND5A and ANAPC1 sequences into the pGL3 vector, digestion was performed using KpnI and Clone Assay:Article Title: In vivo base editing via single myotrophic adeno-associated viruses in dystrophic mouse muscle and satellite cells Article Snippet: .. The AAV-EFS-SaABE8eV106W-bGH-U6-sgRNA-BsmBI was a gift from David Liu (Addgene plasmid # 189924 ; http://n2t.net/addgene:189924 ; RRID:Addgene_189924). gRNA targeting mdx 4cv premature stop codon (4cv-gRNA1: 5’ AGAACAGGAGACAACAGTTGA 3’ or 4cv-gRNA2: 5’ CTGCAGAACAGGAGACAACAG 3’) or a non-targeting gRNA (GCTTTCACGGAGGTTCGACG) was cloned with Article Title: Neuronally sensed oxygen drives behavior and development in human-infective, skin-penetrating nematodes Article Snippet: .. 1 promoter was cloned into pSD10 using Sequencing:Article Title: In vivo base editing via single myotrophic adeno-associated viruses in dystrophic mouse muscle and satellite cells Article Snippet: .. The AAV-EFS-SaABE8eV106W-bGH-U6-sgRNA-BsmBI was a gift from David Liu (Addgene plasmid # 189924 ; http://n2t.net/addgene:189924 ; RRID:Addgene_189924). gRNA targeting mdx 4cv premature stop codon (4cv-gRNA1: 5’ AGAACAGGAGACAACAGTTGA 3’ or 4cv-gRNA2: 5’ CTGCAGAACAGGAGACAACAG 3’) or a non-targeting gRNA (GCTTTCACGGAGGTTCGACG) was cloned with Polymerase Chain Reaction:Article Title: LABCG1 Affects Leishmania ( Leishmania ) Amazonensis Infectivity but Not Virulence or Sand Fly Infection. Article Snippet: .. Both the PCR product and the pSPαZEOα vector were digested with XbaI (Invitrogen) and Article Title: Human respiratory syncytial virus regulates the expression of interferon-stimulated genes through modulation of fibrillarin. Article Snippet: .. Both the plasmid and the PCR-amplified insert were digested with the restriction enzymes BglII (New England Biolabs, #R0144S) and Transgenic Assay:Article Title: Neuronally sensed oxygen drives behavior and development in human-infective, skin-penetrating nematodes Article Snippet: .. 1 promoter was cloned into pSD10 using Concentration Assay:Article Title: Neuronally sensed oxygen drives behavior and development in human-infective, skin-penetrating nematodes Article Snippet: .. 1 promoter was cloned into pSD10 using |