Review



hindiii restriction enzymes  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs hindiii restriction enzymes
    Hindiii Restriction Enzymes, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 10778 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hindiii/HindIII/pmc13180767-58-26-29
    Average 99 stars, based on 10778 article reviews
    hindiii restriction enzymes - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Bioprocessing:

    Article Title: In vivo base editing via single myotrophic adeno-associated viruses in dystrophic mouse muscle and satellite cells
    Article Snippet: .. The AAV-EFS-SaABE8eV106W-bGH-U6-sgRNA-BsmBI was a gift from David Liu (Addgene plasmid # 189924 ; http://n2t.net/addgene:189924 ; RRID:Addgene_189924). gRNA targeting mdx 4cv premature stop codon (4cv-gRNA1: 5’ AGAACAGGAGACAACAGTTGA 3’ or 4cv-gRNA2: 5’ CTGCAGAACAGGAGACAACAG 3’) or a non-targeting gRNA (GCTTTCACGGAGGTTCGACG) was cloned with HindIII (NEB) and NdeI (NEB) to replace the original gRNA sequence in the parental plasmid. ..

    Plasmid Preparation:

    Article Title: In vivo base editing via single myotrophic adeno-associated viruses in dystrophic mouse muscle and satellite cells
    Article Snippet: .. The AAV-EFS-SaABE8eV106W-bGH-U6-sgRNA-BsmBI was a gift from David Liu (Addgene plasmid # 189924 ; http://n2t.net/addgene:189924 ; RRID:Addgene_189924). gRNA targeting mdx 4cv premature stop codon (4cv-gRNA1: 5’ AGAACAGGAGACAACAGTTGA 3’ or 4cv-gRNA2: 5’ CTGCAGAACAGGAGACAACAG 3’) or a non-targeting gRNA (GCTTTCACGGAGGTTCGACG) was cloned with HindIII (NEB) and NdeI (NEB) to replace the original gRNA sequence in the parental plasmid. ..

    Article Title: LABCG1 Affects Leishmania ( Leishmania ) Amazonensis Infectivity but Not Virulence or Sand Fly Infection.
    Article Snippet: .. Both the PCR product and the pSPαZEOα vector were digested with XbaI (Invitrogen) and HindIII (New England Biolabs) and ligated using T4 DNA ligase (Invitrogen) following the manufacturer’s instructions. .. The resulting construct pSPαZEOα/LABCG1 was transformed into Escherichia coli DH5α, ampicillin resistant clones were selected and growth in liquid culture, and plasmids extraction was performed using the Wizard Plus SV Minipreps DNA Purification System (Promega).

    Article Title: Human respiratory syncytial virus regulates the expression of interferon-stimulated genes through modulation of fibrillarin.
    Article Snippet: .. Both the plasmid and the PCR-amplified insert were digested with the restriction enzymes BglII (New England Biolabs, #R0144S) and HindIII (New England Biolabs, #R0104S). .. Following digestion, the plasmid vector was dephosphorylated using alkaline phosphatase (Thermo Fisher Scientific, #EF0652).

    Article Title: Emergence and evolution of chimeric pseudogenes (φgenes) contribute to genetic and functional diversity of the human genome
    Article Snippet: For the full-length and Δ constructs (Δ1 and Δ2) in pUAST, KpnI-HF (NEB, #R3142S) and NotI (NEB, #R0189S) were employed; Δ UP (upstream region) was achieved using NdeI (NEB, #R0111S) and BglII (NEB, #R0144S); Δ TATA promoter using SbfI-HF (NEB, #R3642S) and BglII. .. For insertion of RMND5A and ANAPC1 sequences into the pGL3 vector, digestion was performed using KpnI and HindIII (NEB, #R0104S). ..

    Article Title: Emergence and evolution of chimeric pseudogenes (φgenes) contribute to genetic and functional diversity of the human genome.
    Article Snippet: For the full-length and constructs ( 1 and 2) in pUAST, KpnI-HF (NEB, #R3142S) and NotI (NEB, #R0189S) were employed; UP (upstream region) was achieved using NdeI (NEB, #R0111S) and BglII (NEB, #R0144S); TATA promoter using SbfI-HF (NEB, #R3642S) and BglII. .. For insertion of RMND5A and ANAPC1 sequences into the pGL3 vector, digestion was performed using KpnI and HindIII (NEB, #R0104S). ..

    Clone Assay:

    Article Title: In vivo base editing via single myotrophic adeno-associated viruses in dystrophic mouse muscle and satellite cells
    Article Snippet: .. The AAV-EFS-SaABE8eV106W-bGH-U6-sgRNA-BsmBI was a gift from David Liu (Addgene plasmid # 189924 ; http://n2t.net/addgene:189924 ; RRID:Addgene_189924). gRNA targeting mdx 4cv premature stop codon (4cv-gRNA1: 5’ AGAACAGGAGACAACAGTTGA 3’ or 4cv-gRNA2: 5’ CTGCAGAACAGGAGACAACAG 3’) or a non-targeting gRNA (GCTTTCACGGAGGTTCGACG) was cloned with HindIII (NEB) and NdeI (NEB) to replace the original gRNA sequence in the parental plasmid. ..

    Article Title: Neuronally sensed oxygen drives behavior and development in human-infective, skin-penetrating nematodes
    Article Snippet: .. 1 promoter was cloned into pSD10 using HindIII (New England Biolabs, R3104) and AgeI-HF (New England Biolabs, R3552) to generate pBMW16; to produce transgenic F 1 iL3s, pBMW16 was microinjected at a concentration of 50 ng/μL into S. stercoralis P 0 free-living females . ..

    Sequencing:

    Article Title: In vivo base editing via single myotrophic adeno-associated viruses in dystrophic mouse muscle and satellite cells
    Article Snippet: .. The AAV-EFS-SaABE8eV106W-bGH-U6-sgRNA-BsmBI was a gift from David Liu (Addgene plasmid # 189924 ; http://n2t.net/addgene:189924 ; RRID:Addgene_189924). gRNA targeting mdx 4cv premature stop codon (4cv-gRNA1: 5’ AGAACAGGAGACAACAGTTGA 3’ or 4cv-gRNA2: 5’ CTGCAGAACAGGAGACAACAG 3’) or a non-targeting gRNA (GCTTTCACGGAGGTTCGACG) was cloned with HindIII (NEB) and NdeI (NEB) to replace the original gRNA sequence in the parental plasmid. ..

    Polymerase Chain Reaction:

    Article Title: LABCG1 Affects Leishmania ( Leishmania ) Amazonensis Infectivity but Not Virulence or Sand Fly Infection.
    Article Snippet: .. Both the PCR product and the pSPαZEOα vector were digested with XbaI (Invitrogen) and HindIII (New England Biolabs) and ligated using T4 DNA ligase (Invitrogen) following the manufacturer’s instructions. .. The resulting construct pSPαZEOα/LABCG1 was transformed into Escherichia coli DH5α, ampicillin resistant clones were selected and growth in liquid culture, and plasmids extraction was performed using the Wizard Plus SV Minipreps DNA Purification System (Promega).

    Article Title: Human respiratory syncytial virus regulates the expression of interferon-stimulated genes through modulation of fibrillarin.
    Article Snippet: .. Both the plasmid and the PCR-amplified insert were digested with the restriction enzymes BglII (New England Biolabs, #R0144S) and HindIII (New England Biolabs, #R0104S). .. Following digestion, the plasmid vector was dephosphorylated using alkaline phosphatase (Thermo Fisher Scientific, #EF0652).

    Transgenic Assay:

    Article Title: Neuronally sensed oxygen drives behavior and development in human-infective, skin-penetrating nematodes
    Article Snippet: .. 1 promoter was cloned into pSD10 using HindIII (New England Biolabs, R3104) and AgeI-HF (New England Biolabs, R3552) to generate pBMW16; to produce transgenic F 1 iL3s, pBMW16 was microinjected at a concentration of 50 ng/μL into S. stercoralis P 0 free-living females . ..

    Concentration Assay:

    Article Title: Neuronally sensed oxygen drives behavior and development in human-infective, skin-penetrating nematodes
    Article Snippet: .. 1 promoter was cloned into pSD10 using HindIII (New England Biolabs, R3104) and AgeI-HF (New England Biolabs, R3552) to generate pBMW16; to produce transgenic F 1 iL3s, pBMW16 was microinjected at a concentration of 50 ng/μL into S. stercoralis P 0 free-living females . ..



    Similar Products

    99
    New England Biolabs hindiii restriction enzymes
    Hindiii Restriction Enzymes, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hindiii/HindIII/pmc13180767-58-26-29
    Average 99 stars, based on 1 article reviews
    hindiii restriction enzymes - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    96
    OriGene hindiii
    Hindiii, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hindiii/PCMV6-Neo+Mammalian+Expression+Vector/us12644119-756-24-32
    Average 96 stars, based on 1 article reviews
    hindiii - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    99
    New England Biolabs hindiii digested lambda phage dna
    Hindiii Digested Lambda Phage Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hindiii/HindIII/pmc13179615-117-16-20
    Average 99 stars, based on 1 article reviews
    hindiii digested lambda phage dna - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs restriction enzymes hind iii hf
    Restriction Enzymes Hind Iii Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hindiii/HindIII-HF/pmc13170622-225-23-28
    Average 99 stars, based on 1 article reviews
    restriction enzymes hind iii hf - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs press hindiii
    Press Hindiii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hindiii/HindIII/pm42141022-177-16-18
    Average 99 stars, based on 1 article reviews
    press hindiii - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs r3104s
    R3104s, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hindiii/HindIII-HF/pmc13137149-37-7-2
    Average 99 stars, based on 1 article reviews
    r3104s - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs hindiii cleavage assays
    Hindiii Cleavage Assays, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hindiii/HindIII/pm42129458-118-2-23
    Average 99 stars, based on 1 article reviews
    hindiii cleavage assays - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs hind iii
    Hind Iii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hindiii/HindIII/pm42126281-254-13-15
    Average 99 stars, based on 1 article reviews
    hind iii - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs hindiii hf
    Hindiii Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hindiii/HindIII-HF/pm42129458-118-18-23
    Average 99 stars, based on 1 article reviews
    hindiii hf - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs hindiii
    Hindiii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hindiii/HindIII/bio_rxiv__64898__2026__05__09__721064-192-40-41
    Average 99 stars, based on 1 article reviews
    hindiii - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results