hind iii r0104s restriction enzymes (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
Structured Review
New England Biolabs
hind iii r0104s restriction enzymes
Hind Iii R0104s Restriction Enzymes, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 11018 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/hindiii/HindIII/pmc13651888-299-13-21
Average 99 stars, based on 11018 article reviews
Hind Iii R0104s Restriction Enzymes, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 11018 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/hindiii/HindIII/pmc13651888-299-13-21
Average 99 stars, based on 11018 article reviews
hind iii r0104s restriction enzymes - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
Bioprocessing:Article Title: In vivo base editing via single myotrophic adeno-associated viruses in dystrophic mouse muscle and satellite cells Article Snippet: .. The AAV-EFS-SaABE8eV106W-bGH-U6-sgRNA-BsmBI was a gift from David Liu (Addgene plasmid # 189924 ; http://n2t.net/addgene:189924 ; RRID:Addgene_189924). gRNA targeting mdx 4cv premature stop codon (4cv-gRNA1: 5’ AGAACAGGAGACAACAGTTGA 3’ or 4cv-gRNA2: 5’ CTGCAGAACAGGAGACAACAG 3’) or a non-targeting gRNA (GCTTTCACGGAGGTTCGACG) was cloned with Plasmid Preparation:Article Title: In vivo base editing via single myotrophic adeno-associated viruses in dystrophic mouse muscle and satellite cells Article Snippet: .. The AAV-EFS-SaABE8eV106W-bGH-U6-sgRNA-BsmBI was a gift from David Liu (Addgene plasmid # 189924 ; http://n2t.net/addgene:189924 ; RRID:Addgene_189924). gRNA targeting mdx 4cv premature stop codon (4cv-gRNA1: 5’ AGAACAGGAGACAACAGTTGA 3’ or 4cv-gRNA2: 5’ CTGCAGAACAGGAGACAACAG 3’) or a non-targeting gRNA (GCTTTCACGGAGGTTCGACG) was cloned with Article Title: LABCG1 Affects Leishmania ( Leishmania ) Amazonensis Infectivity but Not Virulence or Sand Fly Infection. Article Snippet: .. Both the PCR product and the pSPαZEOα vector were digested with XbaI (Invitrogen) and Article Title: Duplex Fluorescence Reverse Transcription Loop-Mediated Isothermal Amplification on a Partitioned Nanofluidic Chip Article Snippet: .. To linearize plasmids for transcription, 6 μg of P1041 HA-WT-pTriEx was digested with SpeI, and 6 μg of the P2442 Cov2 Spike plasmid—containing the full-length hemagglutinin from the H3N2 Wyoming/2003 virus—was digested with Article Title: Emergence and evolution of chimeric pseudogenes (φgenes) contribute to genetic and functional diversity of the human genome Article Snippet: For the full-length and Δ constructs (Δ1 and Δ2) in pUAST, KpnI-HF (NEB, #R3142S) and NotI (NEB, #R0189S) were employed; Δ UP (upstream region) was achieved using NdeI (NEB, #R0111S) and BglII (NEB, #R0144S); Δ TATA promoter using SbfI-HF (NEB, #R3642S) and BglII. .. For insertion of RMND5A and ANAPC1 sequences into the pGL3 vector, digestion was performed using KpnI and Clone Assay:Article Title: In vivo base editing via single myotrophic adeno-associated viruses in dystrophic mouse muscle and satellite cells Article Snippet: .. The AAV-EFS-SaABE8eV106W-bGH-U6-sgRNA-BsmBI was a gift from David Liu (Addgene plasmid # 189924 ; http://n2t.net/addgene:189924 ; RRID:Addgene_189924). gRNA targeting mdx 4cv premature stop codon (4cv-gRNA1: 5’ AGAACAGGAGACAACAGTTGA 3’ or 4cv-gRNA2: 5’ CTGCAGAACAGGAGACAACAG 3’) or a non-targeting gRNA (GCTTTCACGGAGGTTCGACG) was cloned with Sequencing:Article Title: In vivo base editing via single myotrophic adeno-associated viruses in dystrophic mouse muscle and satellite cells Article Snippet: .. The AAV-EFS-SaABE8eV106W-bGH-U6-sgRNA-BsmBI was a gift from David Liu (Addgene plasmid # 189924 ; http://n2t.net/addgene:189924 ; RRID:Addgene_189924). gRNA targeting mdx 4cv premature stop codon (4cv-gRNA1: 5’ AGAACAGGAGACAACAGTTGA 3’ or 4cv-gRNA2: 5’ CTGCAGAACAGGAGACAACAG 3’) or a non-targeting gRNA (GCTTTCACGGAGGTTCGACG) was cloned with BAC Assay:Article Title: RNA binding proteome profiling reveals RNA-dependent activation of oncogenic host signaling during KSHV infection Article Snippet: The BACs were purified using the Nucleobond BAC 100 kit (Clontech). .. BAC quality was assessed by digestion with Polymerase Chain Reaction:Article Title: LABCG1 Affects Leishmania ( Leishmania ) Amazonensis Infectivity but Not Virulence or Sand Fly Infection. Article Snippet: .. Both the PCR product and the pSPαZEOα vector were digested with XbaI (Invitrogen) and Ligation:Article Title: AA10 LPMO Homologues as Scaffolds for Engineered Inclusion Bodies and Carrier-Free Biocatalysts Article Snippet: .. The mCherry and α-amylase gBlock inserts were separately ligated into NcoI and Transformation Assay:Article Title: AA10 LPMO Homologues as Scaffolds for Engineered Inclusion Bodies and Carrier-Free Biocatalysts Article Snippet: .. The mCherry and α-amylase gBlock inserts were separately ligated into NcoI and Hemagglutination Assay:Article Title: Duplex Fluorescence Reverse Transcription Loop-Mediated Isothermal Amplification on a Partitioned Nanofluidic Chip Article Snippet: .. To linearize plasmids for transcription, 6 μg of P1041 HA-WT-pTriEx was digested with SpeI, and 6 μg of the P2442 Cov2 Spike plasmid—containing the full-length hemagglutinin from the H3N2 Wyoming/2003 virus—was digested with Virus:Article Title: Duplex Fluorescence Reverse Transcription Loop-Mediated Isothermal Amplification on a Partitioned Nanofluidic Chip Article Snippet: .. To linearize plasmids for transcription, 6 μg of P1041 HA-WT-pTriEx was digested with SpeI, and 6 μg of the P2442 Cov2 Spike plasmid—containing the full-length hemagglutinin from the H3N2 Wyoming/2003 virus—was digested with other:Article Title: Structure and sequence characteristics of 5′-stem-loop 1 modulate the escape from nsp1-mediated repression in SARS-CoV-2 variants Article Snippet: DNA from PCR reactions was purified using the DNA Clean & Concentrator kit (Zymo Research). |